Journal: Journal of Advanced Research

Article Title: SIRT7 facilitates ferroptosis resistance of melanocytes via activating the SMAD3-ATF3-GPX4 signaling pathway in vitiligo

doi: 10.1016/j.jare.2025.07.020

Figure Lengend Snippet: SIRT7 de-acetylated SMAD3 to repress ATF3 transcription . (A) Transcription factor analysis of the ATF3 promoter predicted three SMAD3 binding sites. (B) Enrichment of three SMAD3 binding sites to the promoter of ATF3 by ChIP analysis in PIG1 cells. (n = 3). (C) and (D) Co-IP and immunostaining analysis of the interaction of SMAD3 and SIRT7 in PIG1 cells. (E) IP analysis of the level of acetyl-SMAD3 in PIG1 cells treated with H 2 O 2 (750 μM) for 6 h. (F) and (G) Immunoblotting and immunostaining analysis of the expression of p-SMAD3 and cells were treated with H 2 O 2 (750 μM) for 24 h with or without SIRT7 knockdown. Scale bar = 100 μm (Magnification 630 × ). (H) RT-PCR analysis of the alteration of ATF3 in PIG1 cells with the transfection of siRNA or siSMAD3 under oxidative stress. (n = 3). (I) RT-PCR analysis of the level of ATF3 in SIRT7 knockdown-PIG1 cells with H 2 O 2 (750 μM) treatment for 6 h after being transfected with siSMAD3 or siRNA for 24 h. (n = 3). (J) Enrichment of SMAD3 to the promoter of ATF3 by ChIP analysis in PIG1 cells, and the SIRT7 knockdown-PIG1 cells were treated with H 2 O 2 (750 μM) for 6 h after being transfected with siRNA or siSMAD3 for 24 h. (n = 3). Data were presented as mean ± SEM. **P < 0.01, ***P < 0.001, ns for non-significant (one-way ANOVA and two-tailed Student’s t test).

Article Snippet: For immunoprecipitation, 5–10 μL of SMAD3 antibody (9523S, Cell Signaling Technology, MA, USA), SIRT7 antibody (12994-1-AP, Proteintech, Wuhan, China) or control IgG (30000–0-AP, Proteintech) was mixed with the protein supernatant and incubated at 4°C for 2 h. Then, 25 μL of protein A/G PLUS-Agarose (sc-2003, Santa Cruz Biotechnology, Beijing, China) was mixed with protein lysates.

Techniques: Binding Assay, Co-Immunoprecipitation Assay, Immunostaining, Western Blot, Expressing, Knockdown, Reverse Transcription Polymerase Chain Reaction, Transfection, Two Tailed Test

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9 regulated MMP2, TGF-β1, SMAD2, and SMAD3 expression in MC3T3-E1 cells. MC3T3-E1 cells were pretreated with or without MMP9 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A and B ) MMP9, ( C ) MMP2, ( D ) TGF-β1, ( E ) SMAD2, and ( F ) SMAD3 was measured by qRT-PCR. ( G ) Protein expression of MMP9, MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( H ) phospho-SMAD2 and ( I ) phospho-SMAD3 in MC3T3 cells; scale bar 50 μm. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; t -test or ANOVA.

Article Snippet: For gel mobility super-shift analysis, an anti-SMAD3 antibody (CST) was preincubated with nuclear extracts 10 min prior to adding the radiolabeled probe.

Techniques: Expressing, Transfection, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9 downregulated MMP2 gene transcription through SMAD2/3. A , pGL-Luc-mMMP2-1387/+23 (p1387) was co-transfected with 100 ng pcDNA3.1-SMAD3 or pcDNA3.1-SMAD3 or pCDNA3.1. Transcription results were computed as luciferase activities per mg of total protein. The value obtained from the control group was considered as 1-fold. Fold increases were calculated by dividing the individual value by the control group. B , p1387 Wt, p1387 site1 mut, p1387 site2 mut, or p1387 site1,2 mut were co-transfected with 100 ng pcDNA-Smad2. C , p1387 Wt, p1387 site1 mut, p1387 site2 mut, or p1387 site1,2 mut were co-transfected with 100 ng pcDNA-Smad3. The data are reported as means±SD from independent experiments in triplicate. D , SMAD3 bound to -1368/-1348 in MMP2 promoter region. E , SMAD3 did not bind to -1271/-1251 in MMP2 promoter region. 32 P-labeled double stranded MMP2 probes were incubated with 5 μg of SMAD3 overexpressed cell nuclear extracts. The sequences selected for MMP2 probes are as follows: -1368 to -1348: ( 5'-CAAAGTCTTGTCTGAAGAGGA-3' ), -1271 to -1251: ( 5'-AACCAGAATGTCTGATTTTTA-3' ). Competition analysis of the SMAD3-MMP2 complex formation with 100-fold excess of unlabeled competitors or SBE site 1 mut ( 5'-CAAAGTCTAATTCAAAGAGGA-3' ) or SBE site 2 mut ( 5'- AACCAGAAAATTCAATTTTTA -3' ). Data are reported as means±SD. *P<0.05; ANOVA.

Article Snippet: For gel mobility super-shift analysis, an anti-SMAD3 antibody (CST) was preincubated with nuclear extracts 10 min prior to adding the radiolabeled probe.

Techniques: Transfection, Luciferase, Control, Labeling, Incubation

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9 regulated RUNX2, OSX, ALP, COL I, and OCN expression in lipopolysaccharide (LPS)-induced MC3T3-E1 cells. After pretreatment with pcDNA3.1 or pcDNA3.1-mMMP9 for 48 h, MC3T3-E1 cells were stimulated or not with 20 μg/mL LPS and cultured for another 12 h. mRNA expression of ( A ) MMP2, ( B ) TGF-β1, ( C ) SMAD2, ( D ) SMAD3, ( E ) RUNX2, ( F ) OSX, ( G ) ALP, ( H ) COL I, and ( I ) OCN was measured by qRT-PCR. J , Protein expression of MMP2, TGF-β1, P-SMAD2, SMAD2, P-SMAD3, and SMAD3 was measured by western blot. K , Protein expression of RUNX2, OSX, ALP, COL I, and OCN was measured by western blot. Immunofluorescence analysis of ( L ) phospho-SMAD2 and ( M ) phospho-SMAD3 in MC3T3-E1 cells; scale bar 50 μm. N , Alkaline phosphatase (ALP) staining (a1-a3) and alizarin red S (ARS) staining (b1-b3). O , Quantification of ALP staining. P , Quantification of ARS staining. Data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; ANOVA.

Article Snippet: For gel mobility super-shift analysis, an anti-SMAD3 antibody (CST) was preincubated with nuclear extracts 10 min prior to adding the radiolabeled probe.

Techniques: Expressing, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence, Staining

Journal: Brazilian Journal of Medical and Biological Research

Article Title: MMP9 regulates osteogenesis and MMP2 expression through the TGF-β1/SMAD2/3 signaling pathway in lipopolysaccharide-induced osteoblasts

doi: 10.1590/1414-431X2026e15172

Figure Lengend Snippet: MMP9-regulated MMP2 expression was inhibited by TGF-β1 or SMAD2/3 in MC3T3-E1 cells. MC3T3-E1 cells were pretreated in the presence or absence of TGF-β1 or SMAD2/3 inhibitor for 1 h. After that, cells were transfected with pcDNA3.1 or pcDNA3.1-mMMP9 and cultured for 48 h. mRNA expression of ( A ) MMP2, ( B ) TGF-β1, ( C ) SMAD2, and ( D ) SMAD3 was measured by qRT-PCR. E , Protein expression of MMP2, TGF-β1, SMAD2, SMAD3, phospho-SMAD2, and phospho-SMAD3 was measured by western blot. Immunofluorescence analysis of ( F ) phospho-SMAD2 and ( G ) phospho-SMAD3 in MC3T3-E1 cells; scale bar 50 μm. H , mRNA and ( I ) protein expression of MMP2 was measured by qRT-PCR and western blot. The data are representative of three independent experiments and are reported as means±SD. *P<0.05, **P<0.01; ANOVA.

Article Snippet: For gel mobility super-shift analysis, an anti-SMAD3 antibody (CST) was preincubated with nuclear extracts 10 min prior to adding the radiolabeled probe.

Techniques: Expressing, Transfection, Cell Culture, Quantitative RT-PCR, Western Blot, Immunofluorescence